Hematopoetyczne komórki macierzyste rozmnażają się do momentu narodzin i wykazują odwracalną wadę wszczepienia w fazie ad 9

Kontrole wstrzyknięto PBS zamiast SDF-1G2. Real-time PCR. Komórki zostały posortowane na ml HF / 10, a RNA wyizolowano przy użyciu zestawu izolującego RNA PicoPure (Arcturus) zgodnie z zaleceniami dostawcy, w tym 15-minutowego traktowania DNAse1 (Qiagen) na kolumnie w temperaturze pokojowej. RNA eluowano do objętości 11- (ll i przechowywano w temperaturze <80 ° C. Następnie wytworzono preparat cDNA przy użyciu systemu SuperScript III do syntezy pierwszej nici do RT-PCR (18080093; Invitrogen) zgodnie z zaleceniami producenta, z reakcją przeskalowaną w celu zastosowania 25 ul. Ilościową PCR w czasie rzeczywistym przeprowadzono przy użyciu następujących par primerów (od 5 do 3 (3): a 4int (NM_010576.2) naprzód, AGGACACACCAGGCATTCAT; reverse, CCTCAGTGTTTCGTTTGGTG; CD44 (NM_009851.1) naprzód, CTTTATCCGGAGCACCTTGGCCACC; wstecz, GTCACAGTGCGGGAACTCC; c-Kit (NM_021099.2) naprzód, ACAAGAGGAGATCCGCAAGA; reverse, GAAGCTCAGCAAATCATCCAG; c-mpl (NM_010823.1) naprzód, AGTGGCAGCACCAGTCATCT; wstecz, GAGATGGCTCCAGCACCTT; CXCR4 (NM_009911.2) naprzód, CGGAGTCAGAATCCTCCAGT; reverse, CTGGTCAGTCTCTTATATCTGGAAAA; Gapdh (NM_008084) naprzód, AACTTTGGCATTGTGGAAGG; reverse, ATGCAGGGATGATGTTCTGG; CXCL12 (NM_001012477) naprzód, GAGCCAACGTCAAGCATCTG; reverse, CGGGTCAATGCACACTTGTC; VCAM1 (NM_011693.2) naprzód, TGATTGGGAGAGACAAAGCA; wstecz, AACAACCGAATCCCCAACTT. Względne zmiany ekspresji zostały określone zgodnie z wcześniejszym opisem (76), a transkrypt genów Gapdha był stosowany do normalizacji wyników. Statystyka. Porównania zostały wykonane za pomocą testu Wald. Wartości P mniejsze niż 0,05 uważano za znaczące. Materiały uzupełniające Zobacz Dodatkowe dane Podziękowania Potwierdzamy fachową pomoc techniczną z ośrodka cytometrii przepływowej w laboratorium Terry Fox i Centrum Zasobów Zwierząt Centrum Badań nad Rakiem BC. Uznajemy P. Eirew za doradztwo statystyczne. Prace te były wspierane przez granty National Cancer Institute of Canada (ze środków Fundacji Terry Fox) oraz sieci komórek macierzystych i grant NIH P01 HL-55435 z National Heart, Lung and Blood Institute. M. Bowie i D. Kent byli odbiorcami staży i staży sieci macierzystych finansowanych przez Canadian Institute of Health Research oraz Michael Smith Foundation for Health Research. P. Hoodless to kanadyjski instytut badań nad zdrowiem, nowy badacz i fundacja Michael Smith Foundation for Health Research Scholar. Przypisy Niestandardowe skróty: 4int, 4-integryna; CRU, konkurencyjna jednostka repopulacyjna; CXCL12, ligand chemokiny CXC 12; FACS, sortowanie komórek aktywowane fluorescencyjnie; FL, wątroba płodu; 5-FU, 5-fluorouracyl; HA, kwas hialuronowy; HF / 2, zrównoważony roztwór soli Hanka zawierający 2% FCS; Hst, Hoechst 33342; 3H-Tdr, 3H-tymidyna; lin, marker rodowodu; OPN, osteopontyna; PI, jodek propidyny; Py, pirronina Y; Rho, rodamina-123; SF, współczynnik stali; SP, populacja boczna. Konflikt interesów: Autorzy zadeklarowali brak konfliktu interesów. Informacje referencyjne: J. Clin. Invest.116: 2808. 2816 (2006). doi: 10.1172 / JCI28310 Zobacz powiązany komentarz od strony 2593.
[hasła pokrewne: pizza hawajska składniki, olej kokosowy organiczny, tomografia komputerowa gdynia ]
[patrz też: prawo wykonywania zawodu lekarza, polskie towarzystwo medycyny estetycznej, ursus 11054 ]